EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:154465062-154468533]
Chromosome characteristics of ZNF274[chr1:154465062-154468533]
Back to top
Enhancers possibly regulated by ZNF274[chr1:154465062-154468533]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 154447249 154470672 enh12277
Prostate (PC-3) Brain (SK-N-SH) Brain (SK-N-MC) Lung Blood (OCI-LY7) Lung (A549) Blood (GM12878) Muscle (A673) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Stomach Pancreas (Panc1) Spleen Uterus Blood (T-cell) Heart
chr1 154468503 154468634 vista3380
VISTA
SNP sites on ZNF274[chr1:154465062-154468533]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 154465065 rs6427694 T C 639157
chr1 154465110 rs186663419 G A 639158
chr1 154465494 rs201337223 TG T 639159
chr1 154465542 rs138902050 G A 639160
chr1 154465577 rs73018293 C A,T 639161
chr1 154465592 rs543196985 T TA 639162
chr1 154465748 rs573218267 C A 639163
chr1 154465749 rs540391953 C G 639164
chr1 154465812 rs111866734 G A 639165
chr1 154465837 rs563025215 G C 639166
chr1 154465924 rs117869239 T C 639167
chr1 154465993 rs182910435 G C,T 639168
chr1 154466100 rs115921012 A C 639169
chr1 154466121 rs75485862 C T 639170
chr1 154466188 rs6686276 C A 639171
chr1 154466301 rs59838898 C T 639172
chr1 154466317 rs561264906 CTGCTAGGTGTATTATGCCCAGAATCTCA C 639173
chr1 154466326 rs562830675 G A,C 639174
chr1 154466557 rs114280717 C G 639175
chr1 154466623 rs56860243 C T 639176
chr1 154466627 rs114644527 A T 639177
chr1 154466771 rs566456903 A T 639178
chr1 154467003 rs199901392 GT G 639179
chr1 154467010 rs143076500 T G 639180
chr1 154467119 rs570561996 TTGAC T 639181
chr1 154467192 rs539156924 ATTAT A 639182
chr1 154467226 rs150700236 C G 639183
chr1 154467242 rs541936832 G A 639184
chr1 154467325 rs149255951 C T 639185
chr1 154467357 rs187733509 G A 639186
chr1 154467513 rs532736817 G A 639187
chr1 154467714 rs372734094 G A 639188
chr1 154467816 rs61812631 A T 639189
chr1 154467866 rs553134968 T TAA 639190
chr1 154467893 rs576635548 C A 639191
chr1 154467971 rs4269768 T A 639192
chr1 154468135 rs10047079 T C 639193
chr1 154468210 rs11341057 TA T 639194
chr1 154468210 rs397714597 TA T 639195
chr1 154468210 rs398074320 TA T 639196
chr1 154468403 rs566125499 T C 639197
chr1 154468471 rs558002578 T G 639198
chr1 154468494 rs576361321 A C 639199
Genes possibly regulated by ZNF274[chr1:154465062-154468533]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:154465062-154468533]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results