EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:156487651-156493535]
Chromosome characteristics of ZNF274[chr1:156487651-156493535]
Back to top
Enhancers possibly regulated by ZNF274[chr1:156487651-156493535]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156472305 156489855 enh43055
Cervix (HeLa-S3) Brain (SK-N-MC) Esophagus Blood (GM12878) Stomach Peripheral Blood (MM.1S) Muscle (Myoblast) Muscle (Myotube) Uterus Blood (T-cell) Heart
SNP sites on ZNF274[chr1:156487651-156493535]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156487688 rs1750306 C T 649114
chr1 156487765 rs77411528 C T 649115
chr1 156487846 rs188798386 T C 649116
chr1 156488109 rs11440209 C CT 649117
chr1 156488109 rs397952002 C CT 649118
chr1 156488109 rs559758369 C CT 649119
chr1 156488128 rs542390762 G T 649120
chr1 156488154 rs1778833 A C,G 649121
chr1 156488189 rs537767574 C T 649122
chr1 156488190 rs555909577 G A 649123
chr1 156488260 rs1778832 T C 649124
chr1 156488420 rs1750307 T A 649125
chr1 156488435 rs1778831 A G 649126
chr1 156488458 rs72994682 C T 649127
chr1 156488596 rs79957440 C G 649128
chr1 156488606 rs142740676 G A 649129
chr1 156488625 rs181261506 C T 649130
chr1 156488669 rs72710271 A G 649131
chr1 156488897 rs12085859 A G 649132
chr1 156489076 rs11399213 C CT 649133
chr1 156489076 rs11454421 C CT 649134
chr1 156489145 rs186415243 G A 649135
chr1 156489324 rs189309053 G A 649136
chr1 156489451 rs180853537 C T 649137
chr1 156489543 rs1750308 G A 649138
chr1 156489974 rs1778830 G A 649139
chr1 156490034 rs112064407 G A 649140
chr1 156490101 rs138770160 T A 649141
chr1 156490278 rs149406377 G C 649142
chr1 156490284 rs113081140 C T 649143
chr1 156490302 rs144760680 A G 649144
chr1 156490537 rs111527496 C G 649145
chr1 156490567 rs569800487 T G 649146
chr1 156490589 rs60711781 GC G 649147
chr1 156490589 rs796484681 GC G 649148
chr1 156490609 rs555371569 A G 649149
chr1 156490783 rs35361354 TG T 649150
chr1 156490946 rs34455781 TA T 649151
chr1 156490946 rs796663321 TA T 649152
chr1 156490979 rs10908506 A G 649153
chr1 156491014 rs144133367 A G 649154
chr1 156491040 rs112352304 C T 649155
chr1 156491119 rs147320326 G A,C 649156
chr1 156491157 rs528517409 A T 649157
chr1 156491160 rs112513100 T TTTAA 649158
chr1 156491160 rs56245116 T TTTAA 649159
chr1 156491197 rs547666327 C T 649160
chr1 156491270 rs10908507 C T 649161
chr1 156491271 rs61638995 G A,C 649162
chr1 156491328 rs182800803 C T 649163
chr1 156491337 rs151172500 T C 649164
chr1 156491358 rs139069370 G A 649165
chr1 156491431 rs11264491 C T 649166
chr1 156491466 rs4546909 T C 649167
chr1 156491519 rs557105611 C G 649168
chr1 156491557 rs145030874 G A 649169
chr1 156491600 rs542126349 C T 649170
chr1 156491651 rs188237049 C T 649171
chr1 156491809 rs72994686 C T 649172
chr1 156491985 rs376589513 A G 649173
chr1 156492167 rs11264492 T A 649174
chr1 156492347 rs115130014 T C 649175
chr1 156492746 rs144911386 T C 649176
chr1 156492927 rs7533916 A C 649177
chr1 156492942 rs60322795 C T 649178
chr1 156492972 rs11264493 C T 649179
chr1 156492995 rs373210704 AGATCAAGGCTTCAGTGAGCCAT A 649180
chr1 156492995 rs377303761 AGATCAAGGCTTCAGTGAGCCAT A 649181
chr1 156493062 rs79388977 G A 649182
chr1 156493074 rs7544205 G A 649183
chr1 156493242 rs545011208 T A 649184
chr1 156493244 rs143406117 A AT 649185
chr1 156493317 rs7544455 G A 649186
chr1 156493350 rs111754634 C T 649187
chr1 156493384 rs564773077 A C 649188
chr1 156493398 rs11264494 C T 649189
chr1 156493409 rs192554388 C A 649190
chr1 156493447 rs556699308 G A 649191
Genes possibly regulated by ZNF274[chr1:156487651-156493535]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:156487651-156493535]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results