EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:156650797-156654318]
Chromosome characteristics of ZNF274[chr1:156650797-156654318]
Back to top
Enhancers possibly regulated by ZNF274[chr1:156650797-156654318]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156652128 156666195 enh43056
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Lung (PC-9) Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr1:156650797-156654318]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156650851 rs139592021 G A 650383
chr1 156650909 rs11264516 C T 650384
chr1 156651028 rs200345632 G A 650385
chr1 156651074 rs557443503 C T 650386
chr1 156651107 rs11264517 T A 650387
chr1 156651231 rs377236331 T C 650388
chr1 156651492 rs11264518 C T 650389
chr1 156651511 rs544739079 G A 650390
chr1 156651602 rs11580324 G C,T 650391
chr1 156651660 rs36101248 AC A 650392
chr1 156651690 rs561627490 C A 650393
chr1 156651703 rs185643102 G A 650394
chr1 156651803 rs10737171 A C 650395
chr1 156651816 rs12565861 C T 650396
chr1 156651816 rs143690668 CCTT C 650397
chr1 156652017 rs10908515 A G 650398
chr1 156652165 rs538412403 C T 650399
chr1 156652272 rs115162661 C T 650400
chr1 156652303 rs11264519 A G 650401
chr1 156652562 rs11264520 C A 650402
chr1 156652568 rs12037658 C T 650403
chr1 156652601 rs113657538 G A 650404
chr1 156652755 rs142224733 G T 650405
chr1 156652879 rs368898667 C T 650406
chr1 156652973 rs151209465 C T 650407
chr1 156653017 rs188595288 C T 650408
chr1 156653071 rs72120868 ATATT A 650409
chr1 156653071 rs869080108 ATATT A 650410
chr1 156653140 rs77672820 A G 650411
chr1 156653148 rs11264521 G A 650412
chr1 156653179 rs140392210 G A 650413
chr1 156653297 rs574889286 C T 650414
chr1 156653304 rs115971672 G A 650415
chr1 156653533 rs150204053 G A 650416
chr1 156653628 rs71693539 GGATTGGGGGCTGGGATAGA G 650417
chr1 156653628 rs71703079 GGATTGGGGGCTGGGATAGA G 650418
chr1 156653722 rs560606517 G A 650419
chr1 156653781 rs546532185 G GT 650420
chr1 156653784 rs377441313 TTTTG T 650421
chr1 156653895 rs6699401 G A 650422
chr1 156653927 rs6699490 G A 650423
chr1 156653951 rs181088467 A G 650424
chr1 156654080 rs189387313 G A 650425
chr1 156654135 rs182310985 A G 650426
chr1 156654157 rs374198416 C T 650427
chr1 156654224 rs187382005 A G 650428
chr1 156654305 rs12083509 C T 650429
Genes possibly regulated by ZNF274[chr1:156650797-156654318]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:156650797-156654318]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results