EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:156653579-156654070]
Chromosome characteristics of ZNF143[chr1:156653579-156654070]
Back to top
Enhancers possibly regulated by ZNF143[chr1:156653579-156654070]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156652128 156666195 enh43056
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Lung (PC-9) Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
SNP sites on ZNF143[chr1:156653579-156654070]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156653628 rs71693539 GGATTGGGGGCTGGGATAGA G 650417
chr1 156653628 rs71703079 GGATTGGGGGCTGGGATAGA G 650418
chr1 156653722 rs560606517 G A 650419
chr1 156653781 rs546532185 G GT 650420
chr1 156653784 rs377441313 TTTTG T 650421
chr1 156653895 rs6699401 G A 650422
chr1 156653927 rs6699490 G A 650423
chr1 156653951 rs181088467 A G 650424
Genes possibly regulated by ZNF143[chr1:156653579-156654070]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr1:156653579-156654070]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results