EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:167128666-167129487]
Chromosome characteristics of ZNF274[chr1:167128666-167129487]
Back to top
Enhancers possibly regulated by ZNF274[chr1:167128666-167129487]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167115728 167134954 enh12348
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Neural Stem Cells (H9)
SNP sites on ZNF274[chr1:167128666-167129487]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167128677 rs532081554 C T 699857
chr1 167128700 rs146210317 T G 699858
chr1 167128707 rs181888846 G C 699859
chr1 167128748 rs187329825 G C 699860
chr1 167128755 rs190930096 G A 699861
chr1 167128782 rs11808514 G A 699862
chr1 167128791 rs182637394 C T 699863
chr1 167128792 rs186333556 A G 699864
chr1 167128801 rs11590837 C T 699865
chr1 167129033 rs147443433 G T 699866
chr1 167129131 rs6679415 G A 699867
chr1 167129217 rs540353729 TCCAAGAGCATGGCACTGGCATCTGC T 699868
chr1 167129226 rs569872917 A G 699869
chr1 167129245 rs536366704 TGCTTTTGGTGAGGGCCACGTGCTGTGTCCCAACAGG T 699870
chr1 167129342 rs368745955 T G 699871
Genes possibly regulated by ZNF274[chr1:167128666-167129487]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:167128666-167129487]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results