Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167115728 167134954 enh12348

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167129033 rs147443433 G T 699866
chr1 167129131 rs6679415 G A 699867
chr1 167129217 rs540353729 TCCAAGAGCATGGCACTGGCATCTGC T 699868
chr1 167129226 rs569872917 A G 699869
chr1 167129245 rs536366704 TGCTTTTGGTGAGGGCCACGTGCTGTGTCCCAACAGG T 699870

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results