Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 168828710 168839715 enh79241

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 168834585 rs188447161 A T 712951
chr1 168834586 rs181274311 G A 712952
chr1 168834653 rs184277579 A G 712953
chr1 168834833 rs534966428 C T 712954
chr1 168834878 rs528509883 CTCAAAGATAATAGAGTGTA C 712955
chr1 168834893 rs857632 G A 712956

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results