EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:172609220-172611183]
Chromosome characteristics of ZNF274[chr1:172609220-172611183]
Back to top
Enhancers possibly regulated by ZNF274[chr1:172609220-172611183]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 172604705 172618495 enh27243
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Large Intestine Prostate (RWPE1) Blood (T-cell) Astrocyte Lung (A549) Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Spleen Thymus
SNP sites on ZNF274[chr1:172609220-172611183]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 172609229 rs76486496 A G 729856
chr1 172609306 rs61380813 T G 729857
chr1 172609421 rs2639622 A G 729858
chr1 172609474 rs112467834 C T 729859
chr1 172609579 rs80304939 G A 729860
chr1 172609611 rs114214477 C T 729861
chr1 172609639 rs116513664 C T 729862
chr1 172609656 rs116627969 C T 729863
chr1 172609689 rs113507148 C T 729864
chr1 172609760 rs2639621 T G 729865
chr1 172609888 rs527899141 G A 729866
chr1 172609953 rs114609948 A C 729867
chr1 172610031 rs569883659 C T 729868
chr1 172610040 rs150984557 CATCATACATG C 729869
chr1 172610045 rs180950255 T C,G 729870
chr1 172610077 rs143824888 G C 729871
chr1 172610156 rs570788450 A T 729872
chr1 172610172 rs148154497 C T 729873
chr1 172610350 rs74124267 C T 729874
chr1 172610512 rs34550144 G GAA 729875
chr1 172610512 rs386368753 G GAA 729876
chr1 172610512 rs386368754 G GAA 729877
chr1 172610512 rs58220115 G GAA 729878
chr1 172610589 rs141836019 G GGAATCAGATACTCAGGTGATATCCAC 729879
chr1 172610589 rs71111035 G GGAATCAGATACTCAGGTGATATCCAC 729880
chr1 172610620 rs114869790 C T 729881
chr1 172610710 rs2639620 C G 729882
chr1 172610772 rs142331067 G GACTC 729883
chr1 172610847 rs2639619 T A,C 729884
chr1 172610852 rs150236734 G A,C 729885
chr1 172610947 rs138952447 G A 729886
chr1 172611001 rs10912097 C T 729887
chr1 172611002 rs547020458 G A 729888
chr1 172611019 rs10912098 T C 729889
chr1 172611082 rs569003543 C A 729890
Genes possibly regulated by ZNF274[chr1:172609220-172611183]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:172609220-172611183]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results