Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 182267181 182275215 enh12439
chr1 182269466 182269764 vista4139

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 182268954 rs551864455 AAAGG A 773874
chr1 182268989 rs528087442 A AG 773875
chr1 182269005 rs140713344 G GGA 773876
chr1 182269005 rs199851648 G GGA 773877
chr1 182269014 rs190296161 G A 773878
chr1 182269017 rs72722934 C A 773879
chr1 182269043 rs73056667 A G 773880
chr1 182269110 rs572074028 G A 773881
chr1 182269147 rs4992281 G C 773882
chr1 182269331 rs149468386 G T 773883
chr1 182269359 rs552149541 C T 773884
chr1 182269395 rs3001272 T C 773885
chr1 182269397 rs115894955 G A 773886
chr1 182269424 rs2985429 A G 773887
chr1 182269606 rs4509542 G T 773888
chr1 182269630 rs550008885 A AACCCCAAGAGGGTCTTACAGGAACCC 773889

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results