Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207991765 rs184235177 C T 896375
chr1 207991938 rs74562998 G A 896376
chr1 207991947 rs532011023 G GATCCGCCATCTTGAAGCGC 896377
chr1 207992036 rs561375430 C T 896378
chr1 207992161 rs77451641 G A 896379

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results