EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:207991795-207992125]
Chromosome characteristics of ZNF274[chr1:207991795-207992125]
Back to top
Enhancers possibly regulated by ZNF274[chr1:207991795-207992125]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 207976785 208007638 enh901
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr1:207991795-207992125]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207991938 rs74562998 G A 896376
chr1 207991947 rs532011023 G GATCCGCCATCTTGAAGCGC 896377
chr1 207992036 rs561375430 C T 896378
Genes possibly regulated by ZNF274[chr1:207991795-207992125]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:207991795-207992125]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results