Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234699707 rs534940465 G A,C 1043407
chr1 234699743 rs144703600 A T 1043408
chr1 234699900 rs141539238 C A 1043409
chr1 234699909 rs545127228 C G 1043410
chr1 234700024 rs114641661 C T 1043411
chr1 234700077 rs76708898 G A 1043412
chr1 234700089 rs116610698 G A 1043413
chr1 234700166 rs376025005 G GTCATAGAATCCTAGTGTGTAAC 1043414
chr1 234700166 rs569557655 G GTCATAGAATCCTAGTGTGTAAC 1043415
chr1 234700211 rs559045147 C T 1043416
chr1 234700386 rs6698199 T G 1043417
chr1 234700459 rs16843593 T A,C 1043418
chr1 234700541 rs567486607 T C 1043419
chr1 234700571 rs182832606 C T 1043420
chr1 234700626 rs539011812 G C 1043421
chr1 234700636 rs188668524 C T 1043422

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results