Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234700166 rs376025005 G GTCATAGAATCCTAGTGTGTAAC 1043414
chr1 234700166 rs569557655 G GTCATAGAATCCTAGTGTGTAAC 1043415
chr1 234700211 rs559045147 C T 1043416
chr1 234700386 rs6698199 T G 1043417
chr1 234700459 rs16843593 T A,C 1043418
chr1 234700541 rs567486607 T C 1043419
chr1 234700571 rs182832606 C T 1043420

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results