EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:24841411-24841641]
Chromosome characteristics of ZNF274[chr10:24841411-24841641]
Back to top
Enhancers possibly regulated by ZNF274[chr10:24841411-24841641]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 24838185 24848335 enh13063
Prostate (PC-3) Liver (HepG2) Esophagus Stomach Muscle (A673) Placenta Spleen Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF274[chr10:24841411-24841641]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 24841474 rs373610826 TCACACCCCTCGAGGCCTCAC T 1270519
chr10 24841474 rs68005654 TCACACCCCTCGAGGCCTCAC T 1270520
chr10 24841476 rs547964813 ACACCCCTCGAGGCCT A 1270521
chr10 24841498 rs2482017 A G 1270522
chr10 24841506 rs573303605 A G 1270523
Genes possibly regulated by ZNF274[chr10:24841411-24841641]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:24841411-24841641]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results