EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:88170482-88170852]
Chromosome characteristics of ZNF274[chr10:88170482-88170852]
Back to top
Enhancers possibly regulated by ZNF274[chr10:88170482-88170852]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 88167845 88181195 enh1395
Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Pancreas Uterus Thymus Heart
SNP sites on ZNF274[chr10:88170482-88170852]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 88170528 rs150730965 T C 1551886
chr10 88170764 rs555760856 G GTGGAGTTTGGCAGAGCTCAGTGGGCATAGCTTATCCTTCTCCACA 1551887
chr10 88170832 rs560627619 T G 1551888
chr10 88170850 rs561330605 C A 1551889
Genes possibly regulated by ZNF274[chr10:88170482-88170852]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:88170482-88170852]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results