EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr10:100122856-100123426]
Chromosome characteristics of ZNF217[chr10:100122856-100123426]
Back to top
Enhancers possibly regulated by ZNF217[chr10:100122856-100123426]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 100118700 100127775 enh13446
Bone Marrow (K562) Epithelial (MCF-7) Esophagus Astrocyte Bone (Osteoblast) Stomach Placenta Thyroid Peripheral Blood (MM.1S) Lung (PC-9) Uterus Heart
SNP sites on ZNF217[chr10:100122856-100123426]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 100122943 rs576332661 TGGTTGCAGAAATAAAAATTTCTGTAACA T 1608673
chr10 100123075 rs115923003 T A 1608674
chr10 100123086 rs557851326 G A,T 1608675
chr10 100123196 rs537658403 C A 1608676
chr10 100123382 rs139022173 A G 1608677
Genes possibly regulated by ZNF217[chr10:100122856-100123426]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr10:100122856-100123426]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results