EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:100125184-100125931]
Chromosome characteristics of ZNF274[chr10:100125184-100125931]
Back to top
Enhancers possibly regulated by ZNF274[chr10:100125184-100125931]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 100118700 100127775 enh13446
Bone Marrow (K562) Epithelial (MCF-7) Esophagus Astrocyte Bone (Osteoblast) Stomach Placenta Thyroid Peripheral Blood (MM.1S) Lung (PC-9) Uterus Heart
SNP sites on ZNF274[chr10:100125184-100125931]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 100125203 rs11592388 C T 1608700
chr10 100125216 rs4917830 G A 1608701
chr10 100125266 rs138173267 G A 1608702
chr10 100125309 rs537053131 G A 1608703
chr10 100125324 rs529942304 CGTCAGAACTTCCGTCCGTCTTT C 1608704
chr10 100125325 rs78175367 G A 1608705
chr10 100125416 rs73331710 C T 1608706
chr10 100125424 rs558000283 CA C 1608707
chr10 100125558 rs7083016 A G 1608708
chr10 100125562 rs530807317 C T 1608709
chr10 100125575 rs542704179 G A 1608710
chr10 100125588 rs561414411 C T 1608711
chr10 100125647 rs570004758 C A 1608712
chr10 100125789 rs555219239 CCACCCGCCTGGCCA C 1608713
chr10 100125841 rs144485277 G A,T 1608714
chr10 100125851 rs189716353 C T 1608715
chr10 100125911 rs11817477 A G 1608716
Genes possibly regulated by ZNF274[chr10:100125184-100125931]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:100125184-100125931]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results