Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 100118700 100127775 enh13446

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 100125309 rs537053131 G A 1608703
chr10 100125324 rs529942304 CGTCAGAACTTCCGTCCGTCTTT C 1608704
chr10 100125325 rs78175367 G A 1608705
chr10 100125416 rs73331710 C T 1608706
chr10 100125424 rs558000283 CA C 1608707
chr10 100125558 rs7083016 A G 1608708
chr10 100125562 rs530807317 C T 1608709
chr10 100125575 rs542704179 G A 1608710
chr10 100125588 rs561414411 C T 1608711
chr10 100125647 rs570004758 C A 1608712
chr10 100125789 rs555219239 CCACCCGCCTGGCCA C 1608713

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results