EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr10:100136209-100136705]
Chromosome characteristics of ZNF217[chr10:100136209-100136705]
Back to top
Enhancers possibly regulated by ZNF217[chr10:100136209-100136705]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 100128465 100142774 enh28390
Prostate (PC-3) Epithelial (MCF-7) Astrocyte Bone (Osteoblast) Thyroid Uterus Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on ZNF217[chr10:100136209-100136705]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 100136233 rs559402521 T C 1608856
chr10 100136262 rs372006695 T TCATTTTTAGCATTTTTAGCATTTTTAGCATTTCAA 1608857
chr10 100136262 rs61444248 T TCATTTTTAGCATTTTTAGCATTTTTAGCATTTCAA 1608858
chr10 100136420 rs116687408 G A 1608859
chr10 100136560 rs12258123 G A 1608860
Genes possibly regulated by ZNF217[chr10:100136209-100136705]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr10:100136209-100136705]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results