Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 513034 521095 enh13673

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 518990 rs74214836 G C,T 1787070
chr11 518999 rs375419641 C G 1787071
chr11 519012 rs186960061 G C 1787072
chr11 519043 rs112338336 G A 1787073
chr11 519044 rs112449497 C G,T 1787074
chr11 519045 rs74045399 T C 1787075
chr11 519053 rs568156126 G GTCCGCTGTGCAAACCGGTCCT 1787076
chr11 519077 rs72841204 C T 1787077

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results