EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:3857257-3860228]
Chromosome characteristics of ZNF274[chr11:3857257-3860228]
Back to top
Enhancers possibly regulated by ZNF274[chr11:3857257-3860228]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 3850985 3860835 enh1616
Bone Marrow (K562) Large Intestine Esophagus Blood (OCI-LY7) Blood (GM12878) Stomach Blood (Karpas-422) Neural Stem Cells (H9) Heart
chr11 3859822 3860019 vista9465
VISTA
chr11 3860220 3860837 vista9466
VISTA
SNP sites on ZNF274[chr11:3857257-3860228]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 3857276 rs553886593 T C 1812026
chr11 3857282 rs58765611 TA T 1812027
chr11 3857282 rs796376886 TA T 1812028
chr11 3857325 rs147415635 G A 1812029
chr11 3857381 rs188720092 G A 1812030
chr11 3857459 rs80273407 C T 1812031
chr11 3857608 rs397973950 G GA 1812032
chr11 3857608 rs60712252 G GA 1812033
chr11 3857619 rs184346463 T C 1812034
chr11 3857821 rs10835178 T C 1812035
chr11 3857938 rs536428874 G A,C 1812036
chr11 3857967 rs11030002 A G 1812037
chr11 3858074 rs12363789 G A 1812038
chr11 3858091 rs183873840 C T 1812039
chr11 3858188 rs539087345 T C 1812040
chr11 3858218 rs189039759 C T 1812041
chr11 3858222 rs534584725 C A,G 1812042
chr11 3858284 rs150581912 G A 1812043
chr11 3858411 rs181674196 C T 1812044
chr11 3858616 rs11030008 G A 1812045
chr11 3858666 rs147590916 TAC T 1812046
chr11 3858666 rs373543441 TAC T 1812047
chr11 3858720 rs139470027 T A 1812048
chr11 3858738 rs146490351 G GCAGT 1812049
chr11 3858749 rs57000758 G C 1812050
chr11 3858802 rs149674997 A G 1812051
chr11 3858844 rs182206063 T C 1812052
chr11 3858981 rs185352750 C T 1812053
chr11 3859025 rs11030010 T C 1812054
chr11 3859072 rs114268143 G A 1812055
chr11 3859386 rs1349542 A G 1812056
chr11 3859427 rs547342468 C T 1812057
chr11 3859440 rs114657320 G T 1812058
chr11 3859496 rs563370698 G GC 1812059
chr11 3859609 rs74053503 G C 1812060
chr11 3859682 rs10835181 C T 1812061
chr11 3859712 rs142633216 GAAAGTGCCTTGTATGCACATCCTTCTCTA G 1812062
chr11 3859712 rs75569785 GAAAGTGCCTTGTATGCACATCCTTCTCTA G 1812063
chr11 3859856 rs10835182 T A 1812064
chr11 3859884 rs35591517 G GA 1812065
chr11 3859884 rs398044967 G GA 1812066
chr11 3860085 rs151107568 A G 1812067
chr11 3860087 rs546508749 T C 1812068
chr11 3860221 rs543250850 T A 1812069
Genes possibly regulated by ZNF274[chr11:3857257-3860228]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 3848208 3862213 - RHOG ENSG00000177105.9 3862213 0.83 1.0 1985 10435
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr11:3857257-3860228]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results