| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 3859496 | rs563370698 | G | GC | 1812059 | |
| chr11 | 3859609 | rs74053503 | G | C | 1812060 | |
| chr11 | 3859682 | rs10835181 | C | T | 1812061 | |
| chr11 | 3859712 | rs142633216 | GAAAGTGCCTTGTATGCACATCCTTCTCTA | G | 1812062 | |
| chr11 | 3859712 | rs75569785 | GAAAGTGCCTTGTATGCACATCCTTCTCTA | G | 1812063 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr11 | 3848208 | 3862213 | - | RHOG | ENSG00000177105.9 | 3862213 | 0.83 | 1.0 | 2381 | 10435 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|