Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12092410 rs11022151 C G 1853212
chr11 12092458 rs373037695 T A 1853213
chr11 12092578 rs137926953 C T 1853214
chr11 12092671 rs149471892 C T 1853215
chr11 12092672 rs147169100 C A 1853216
chr11 12092746 rs559737241 T G 1853217
chr11 12092794 rs151128391 TGGATGGAACAGGGGCTCCTCA T 1853218
chr11 12092794 rs35745946 TGGATGGAACAGGGGCTCCTCA T 1853219

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results