Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 61467758 rs543914436 C T 2026227
chr11 61467776 rs577797819 C CAGCCTGTCTGCAGGCCCTCCTGCAAGGAG 2026228
chr11 61467947 rs369538605 C A 2026229
chr11 61467979 rs141252626 G A 2026230

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results