EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr11:61467735-61468119]
Chromosome characteristics of ZZZ3[chr11:61467735-61468119]
Back to top
Enhancers possibly regulated by ZZZ3[chr11:61467735-61468119]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 61449565 61471181 enh13960
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr11 61467819 61468013 vista10460
VISTA
SNP sites on ZZZ3[chr11:61467735-61468119]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 61467758 rs543914436 C T 2026227
chr11 61467776 rs577797819 C CAGCCTGTCTGCAGGCCCTCCTGCAAGGAG 2026228
chr11 61467947 rs369538605 C A 2026229
chr11 61467979 rs141252626 G A 2026230
chr11 61468095 rs145095263 G C 2026231
Genes possibly regulated by ZZZ3[chr11:61467735-61468119]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr11:61467735-61468119]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results