Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 62159305 62166415 enh13970

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 62165723 rs371244567 CCCTGCGCCACCACCAGGAAAGGA C 2030765
chr11 62165806 rs11231076 G A 2030766

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results