EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:63572338-63572670]
Chromosome characteristics of ZNF274[chr11:63572338-63572670]
Back to top
Enhancers possibly regulated by ZNF274[chr11:63572338-63572670]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63567865 63575755 enh13983
Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Stomach Placenta Colon (HCT116) Pancreas (Panc1) Pancreas Spleen Muscle (Myotube) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF274[chr11:63572338-63572670]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63572339 rs141312475 A C 2035724
chr11 63572363 rs535864448 CCGCCACACCCAGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTT C 2035725
chr11 63572386 rs185530562 T C 2035726
chr11 63572459 rs189554973 C T 2035727
chr11 63572518 rs580155 A G 2035728
chr11 63572625 rs10897448 C T 2035729
chr11 63572628 rs544316024 G A 2035730
Genes possibly regulated by ZNF274[chr11:63572338-63572670]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:63572338-63572670]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results