EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:64980452-64981760]
Chromosome characteristics of ZNF274[chr11:64980452-64981760]
Back to top
Enhancers possibly regulated by ZNF274[chr11:64980452-64981760]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 64977405 64995695 enh1823
Bone Marrow (K562) Large Intestine Prostate (RWPE1) Bone (Osteoblast) Muscle (A673) Placenta Colon (HCT116) Uterus Blood (Karpas-422) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Epithelial (MCF-7)
SNP sites on ZNF274[chr11:64980452-64981760]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 64980496 rs560301680 T C 2044118
chr11 64980685 rs551337672 A G 2044119
chr11 64980918 rs139698223 A G 2044120
chr11 64980983 rs17882241 G A,C 2044121
chr11 64981190 rs17884655 CACCTGAACCCTCCTATGGGGTGTA C 2044122
chr11 64981190 rs556463177 CACCTGAACCCTCCTATGGGGTGTA C 2044123
chr11 64981472 rs239258 G A,C 2044124
chr11 64981485 rs547723417 C G 2044125
chr11 64981522 rs11605576 C A 2044126
chr11 64981556 rs73480963 C T 2044127
chr11 64981587 rs11605632 G A 2044128
chr11 64981653 rs371972039 G A 2044129
chr11 64981718 rs368618346 G C 2044130
chr11 64981747 rs189315673 G C 2044131
Genes possibly regulated by ZNF274[chr11:64980452-64981760]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:64980452-64981760]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results