EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:119303930-119304240]
Chromosome characteristics of ZNF274[chr11:119303930-119304240]
Back to top
Enhancers possibly regulated by ZNF274[chr11:119303930-119304240]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 119301086 119321335 enh2045
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Muscle (A673) Blood (Karpas-422) Muscle (Myoblast) Spleen Muscle (Myotube) Uterus Thymus
SNP sites on ZNF274[chr11:119303930-119304240]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 119304002 rs11217280 A G 2303903
chr11 119304031 rs547749583 TGTGCATGTGTGTGTGTGCACGCGC T 2303904
chr11 119304051 rs79366264 C T 2303905
chr11 119304053 rs11217281 C T 2303906
chr11 119304053 rs541647722 C CGTGCATGTGTGCACGT 2303907
chr11 119304090 rs10790293 A C 2303908
chr11 119304238 rs12283157 G C 2303909
Genes possibly regulated by ZNF274[chr11:119303930-119304240]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:119303930-119304240]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results