Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 46734425 46739495 enh75028

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 46736627 rs116454344 C T 2603081
chr12 46736628 rs146922272 T A 2603082
chr12 46736646 rs12816358 A G 2603083
chr12 46736694 rs73282561 G A 2603084
chr12 46736729 rs12317787 T C 2603085
chr12 46736791 rs370204072 GCCCCAAGGCTCTACAATCAGTAGGTGGTGAAGCCA G 2603086
chr12 46736793 rs79708652 C T 2603087

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results