EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr12:68628770-68629236]
Chromosome characteristics of ZNF143[chr12:68628770-68629236]
Back to top
Enhancers possibly regulated by ZNF143[chr12:68628770-68629236]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 68628335 68641815 enh29675
Prostate (PC-3) Cervix (HeLa-S3) Blood (T-cell) Esophagus Astrocyte Stomach Peripheral Blood (MM.1S) Lung (PC-9) Pancreas (Panc1) Uterus Thymus Epithelial (MCF-7)
SNP sites on ZNF143[chr12:68628770-68629236]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 68628857 rs145802258 A G 2709556
chr12 68628860 rs12321401 A G 2709557
chr12 68629037 rs111344833 C T 2709558
chr12 68629045 rs150366891 A G 2709559
chr12 68629068 rs566545609 T C 2709560
chr12 68629071 rs144440382 T TA 2709561
chr12 68629128 rs376937758 A AACAAACATATCACTCTGGTG 2709562
chr12 68629128 rs543787151 A AACAAACATATCACTCTGGTG 2709563
chr12 68629206 rs12321629 A C 2709564
chr12 68629212 rs80088855 T G 2709565
Genes possibly regulated by ZNF143[chr12:68628770-68629236]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr12:68628770-68629236]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results