Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 93518625 rs141670328 G GAT 2809170
chr12 93518976 rs79038319 C T 2809171
chr12 93519256 rs563086612 ATTTTTAATTAACATGTAAG A 2809172

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results