EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr12:121365978-121366376]
Chromosome characteristics of ZNF143[chr12:121365978-121366376]
Back to top
Enhancers possibly regulated by ZNF143[chr12:121365978-121366376]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 121361505 121369371 enh15050
Skin (Keratinocyte) Prostate (PC-3) Large Intestine Placenta Lung (PC-9) Pancreas Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF143[chr12:121365978-121366376]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 121366197 rs534524292 G GATATATTATATATTATATAT 2949098
chr12 121366255 rs556843387 C A 2949099
chr12 121366346 rs571594507 T TG 2949100
Genes possibly regulated by ZNF143[chr12:121365978-121366376]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr12:121365978-121366376]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results