EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr12:125068419-125068795]
Chromosome characteristics of ZZZ3[chr12:125068419-125068795]
Back to top
Enhancers possibly regulated by ZZZ3[chr12:125068419-125068795]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 125063773 125079595 enh30030
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Prostate (RWPE1) Esophagus Astrocyte Lung Stomach Spleen Muscle (Myotube) Uterus Heart
SNP sites on ZZZ3[chr12:125068419-125068795]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 125068574 rs73427650 C A,T 2970659
chr12 125068663 rs1243001 A G 2970660
chr12 125068683 rs560497667 AG A 2970661
chr12 125068759 rs139912611 A AACAGCCACACTGCTGGTAGC 2970662
chr12 125068759 rs71092210 A AACAGCCACACTGCTGGTAGC 2970663
chr12 125068785 rs564956809 C A 2970664
Genes possibly regulated by ZZZ3[chr12:125068419-125068795]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr12:125068419-125068795]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results