EnhancerDB
  1. Home
  2. TFBS
  3. TEF1[chr13:114062158-114063364]
Chromosome characteristics of TEF1[chr13:114062158-114063364]
Back to top
Enhancers possibly regulated by TEF1[chr13:114062158-114063364]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114060593 114075215 enh3025
Liver (HepG2) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Stomach Blood (Karpas-422) Uterus Heart
SNP sites on TEF1[chr13:114062158-114063364]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114062324 rs549984731 G A 3410261
chr13 114062336 rs193114203 C T 3410262
chr13 114062392 rs539150787 C T 3410263
chr13 114062402 rs557866169 G A 3410264
chr13 114062532 rs141404475 C A,T 3410265
chr13 114062577 rs150279387 T C 3410266
chr13 114062995 rs138885878 T G 3410267
chr13 114063008 rs9549772 A T 3410268
chr13 114063128 rs544542216 C T 3410269
chr13 114063129 rs371566768 T G 3410270
chr13 114063154 rs536372099 C CAGGGGAGGAGGGGGCTGCAGAGAGG 3410271
chr13 114063192 rs183753670 G C 3410272
chr13 114063240 rs117636647 C T 3410273
chr13 114063346 rs561933917 A G 3410274
Genes possibly regulated by TEF1[chr13:114062158-114063364]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TEF1[chr13:114062158-114063364]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results