| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr13 | 114060593 | 114075215 | enh3025 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr13 | 114062995 | rs138885878 | T | G | 3410267 | |
| chr13 | 114063008 | rs9549772 | A | T | 3410268 | |
| chr13 | 114063128 | rs544542216 | C | T | 3410269 | |
| chr13 | 114063129 | rs371566768 | T | G | 3410270 | |
| chr13 | 114063154 | rs536372099 | C | CAGGGGAGGAGGGGGCTGCAGAGAGG | 3410271 | |
| chr13 | 114063192 | rs183753670 | G | C | 3410272 | |
| chr13 | 114063240 | rs117636647 | C | T | 3410273 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|