EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:50406865-50407343]
Chromosome characteristics of ZNF143[chr14:50406865-50407343]
Back to top
Enhancers possibly regulated by ZNF143[chr14:50406865-50407343]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 50404685 50423155 enh15589
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Esophagus Blood (T-cell) Blood (OCI-LY7) Stomach Muscle (A673) Placenta Colon (HCT116) Pancreas (Panc1) Lung (PC-9) Spleen Thymus Epithelial (MCF-7)
SNP sites on ZNF143[chr14:50406865-50407343]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 50406917 rs539193208 ACTAGGAAGAAGATATGACTTC A 3526957
chr14 50406944 rs528986623 A G 3526958
chr14 50407015 rs56009368 G A 3526959
chr14 50407028 rs7141983 A G 3526960
chr14 50407048 rs372683352 C T 3526961
chr14 50407168 rs7142476 C A,G,T 3526962
chr14 50407229 rs7142800 G C 3526963
Genes possibly regulated by ZNF143[chr14:50406865-50407343]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:50406865-50407343]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results