Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100677385 100692855 enh3451

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100677240 rs565647116 CTGGATCATTATTTTTTAAAAATCTT C 3788483
chr14 100677287 rs368932188 A G 3788484
chr14 100677417 rs115724485 G A 3788485
chr14 100677437 rs61992890 G T 3788486

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results