Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100677385 100692855 enh3451

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100677700 rs114598549 G A 3788487
chr14 100677812 rs34260019 C T 3788488
chr14 100677824 rs183687289 C T 3788489
chr14 100677838 rs73351455 A G 3788490
chr14 100677859 rs560896134 C T 3788491
chr14 100677906 rs11625290 G C 3788492
chr14 100677911 rs546007526 TCAGGCTCTTCCCAGTGCCC T 3788493
chr14 100678008 rs77186028 G A 3788494

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results