Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100677385 100692855 enh3451

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100677906 rs11625290 G C 3788492
chr14 100677911 rs546007526 TCAGGCTCTTCCCAGTGCCC T 3788493
chr14 100678008 rs77186028 G A 3788494
chr14 100678121 rs538289026 G A 3788495
chr14 100678136 rs114313658 C T 3788496
chr14 100678143 rs148656128 T C 3788497
chr14 100678283 rs141361067 G A 3788498
chr14 100678342 rs61992891 G A,C 3788499
chr14 100678345 rs150786164 C A 3788500
chr14 100678407 rs61992892 T C 3788501
chr14 100678478 rs552790706 TCTCCTTCCCCC T 3788502

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results