Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101160420 rs71424412 G A 3792033
chr14 101160421 rs572464022 C T 3792034
chr14 101160550 rs140881428 AGCGGGGGCGGCCCTTGGGAGGT A 3792035
chr14 101160550 rs79600911 AGCGGGGGCGGCCCTTGGGAGGT A 3792036
chr14 101160581 rs142033254 GCCCA G 3792037
chr14 101160581 rs145253974 GCCCA G 3792038
chr14 101160605 rs115110370 T C 3792039

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results