EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:101160432-101160625]
Chromosome characteristics of ZNF274[chr14:101160432-101160625]
Back to top
Enhancers possibly regulated by ZNF274[chr14:101160432-101160625]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 101149651 101181204 enh15945
Bone Marrow (K562) Skin (Keratinocyte) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Ovary Astrocyte Lung (PC-9) Bone (Osteoblast) Muscle (A673) Placenta Colon (HCT116) Muscle (Myoblast) Pancreas Pancreas (Panc1) Uterus Epithelial (MCF-7)
SNP sites on ZNF274[chr14:101160432-101160625]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101160550 rs140881428 AGCGGGGGCGGCCCTTGGGAGGT A 3792035
chr14 101160550 rs79600911 AGCGGGGGCGGCCCTTGGGAGGT A 3792036
chr14 101160581 rs142033254 GCCCA G 3792037
chr14 101160581 rs145253974 GCCCA G 3792038
chr14 101160605 rs115110370 T C 3792039
Genes possibly regulated by ZNF274[chr14:101160432-101160625]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:101160432-101160625]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results