Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 102527288 102532575 enh15960

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 102527237 rs141412157 T C 3801811
chr14 102527392 rs1190616 G A 3801812
chr14 102527407 rs538454816 T C 3801813
chr14 102527457 rs554297547 G A 3801814
chr14 102527480 rs182240042 G C 3801815
chr14 102527531 rs138064032 G A 3801816
chr14 102527591 rs149537261 G T 3801817
chr14 102527638 rs114387979 G A 3801818
chr14 102527663 rs571631763 G GA 3801819
chr14 102527768 rs144007781 G A,T 3801820
chr14 102527899 rs191780496 C T 3801821
chr14 102527980 rs184325374 C T 3801822
chr14 102528013 rs188309376 G A 3801823
chr14 102528064 rs34680253 GA G 3801824
chr14 102528064 rs397803557 GA G 3801825
chr14 102528064 rs539182041 GA G 3801826
chr14 102528064 rs567398039 GAA G 3801827
chr14 102528335 rs190240543 G C 3801828
chr14 102528360 rs74373954 G A 3801829
chr14 102528395 rs74081981 G C 3801830
chr14 102528424 rs539956105 C T 3801831
chr14 102528427 rs77011345 T C 3801832
chr14 102528523 rs150322645 ATACTCCAACTTG A 3801833
chr14 102528523 rs376603496 ATACTCCAACTTG A 3801834
chr14 102528562 rs75212944 G A 3801835
chr14 102528678 rs367760490 CTGTAGCCCAGGCTGGAGTCACGCTG C 3801836
chr14 102528678 rs537470207 CTGTAGCCCAGGCTGGAGTCACGCTG C 3801837
chr14 102528679 rs553969529 T C 3801838
chr14 102528703 rs1190617 G C 3801839
chr14 102528809 rs142823353 C G,T 3801840
chr14 102528817 rs111403867 C T 3801841
chr14 102528966 rs557363638 C CT 3801842
chr14 102528975 rs571065237 T A 3801843
chr14 102529066 rs116054751 A T 3801844

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results