EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:102528305-102528940]
Chromosome characteristics of ZNF274[chr14:102528305-102528940]
Back to top
Enhancers possibly regulated by ZNF274[chr14:102528305-102528940]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 102527288 102532575 enh15960
Bone Marrow (K562) Cervix (HeLa-S3) Brain (SK-N-MC) Ovary Esophagus Placenta Colon (HCT116) Pancreas Uterus Epithelial (MCF-7)
SNP sites on ZNF274[chr14:102528305-102528940]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 102528335 rs190240543 G C 3801828
chr14 102528360 rs74373954 G A 3801829
chr14 102528395 rs74081981 G C 3801830
chr14 102528424 rs539956105 C T 3801831
chr14 102528427 rs77011345 T C 3801832
chr14 102528523 rs150322645 ATACTCCAACTTG A 3801833
chr14 102528523 rs376603496 ATACTCCAACTTG A 3801834
chr14 102528562 rs75212944 G A 3801835
chr14 102528678 rs367760490 CTGTAGCCCAGGCTGGAGTCACGCTG C 3801836
chr14 102528678 rs537470207 CTGTAGCCCAGGCTGGAGTCACGCTG C 3801837
chr14 102528679 rs553969529 T C 3801838
chr14 102528703 rs1190617 G C 3801839
chr14 102528809 rs142823353 C G,T 3801840
chr14 102528817 rs111403867 C T 3801841
Genes possibly regulated by ZNF274[chr14:102528305-102528940]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:102528305-102528940]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results