Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103689565 103704655 enh51942

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103693435 rs1190198 T C 3811951
chr14 103693438 rs578002940 G A 3811952
chr14 103693488 rs557137760 G C 3811953
chr14 103693558 rs541071392 A G 3811954
chr14 103693598 rs36126645 A T 3811955
chr14 103693600 rs10718805 AG A 3811956
chr14 103693663 rs201818945 G GGCCTCCGGCTGCACCCTGGT 3811957
chr14 103693663 rs373007262 G GGCCTCCGGCTGCACCCTGGT 3811958
chr14 103693718 rs114864249 T C 3811959
chr14 103693735 rs117410677 C G 3811960
chr14 103693758 rs17101365 T A 3811961
chr14 103693853 rs76666783 C T 3811962
chr14 103693854 rs150395685 G A,T 3811963
chr14 103693861 rs1190199 T C 3811964

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results