EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:103698615-103698975]
Chromosome characteristics of ZZZ3[chr14:103698615-103698975]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:103698615-103698975]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103689565 103704655 enh51942
Cervix (HeLa-S3) Prostate (RWPE1) Large Intestine Muscle (A673) Lung (PC-9) Spleen Uterus Stomach
SNP sites on ZZZ3[chr14:103698615-103698975]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103698643 rs116817955 T C,G 3812063
chr14 103698656 rs62008719 G A,C 3812064
chr14 103698669 rs28701827 G T 3812065
chr14 103698752 rs28705784 T C 3812066
chr14 103698795 rs28655326 A G 3812067
chr14 103698807 rs28699419 C G 3812068
chr14 103698808 rs371180432 G A 3812069
chr14 103698812 rs188570058 T A 3812070
chr14 103698908 rs2763557 A G 3812071
chr14 103698912 rs374146336 G A 3812072
chr14 103698956 rs200854402 GGGGCTGGGCAGCAGGAGGGCA G 3812073
chr14 103698963 rs567110398 G A 3812074
chr14 103698973 rs536083667 G A 3812075
Genes possibly regulated by ZZZ3[chr14:103698615-103698975]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:103698615-103698975]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results