Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103689565 103704655 enh51942

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103698669 rs28701827 G T 3812065
chr14 103698752 rs28705784 T C 3812066
chr14 103698795 rs28655326 A G 3812067
chr14 103698807 rs28699419 C G 3812068
chr14 103698808 rs371180432 G A 3812069
chr14 103698812 rs188570058 T A 3812070
chr14 103698908 rs2763557 A G 3812071
chr14 103698912 rs374146336 G A 3812072
chr14 103698956 rs200854402 GGGGCTGGGCAGCAGGAGGGCA G 3812073
chr14 103698963 rs567110398 G A 3812074
chr14 103698973 rs536083667 G A 3812075
chr14 103698984 rs555439840 G A 3812076

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results