EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:104007096-104007626]
Chromosome characteristics of ZZZ3[chr14:104007096-104007626]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:104007096-104007626]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104001265 104021295 enh15979
Brain (SK-N-MC) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Uterus Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZZZ3[chr14:104007096-104007626]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104007161 rs541000499 T C 3815149
chr14 104007192 rs564390568 A G 3815150
chr14 104007242 rs78456219 G A 3815151
chr14 104007304 rs370478626 A C 3815152
chr14 104007500 rs11160753 C T 3815153
chr14 104007535 rs190626374 G A 3815154
chr14 104007539 rs112588986 G A 3815155
chr14 104007539 rs144093365 G GACAGGCTTGTTGCGAAGCA,GACAGGCTTGTTGTGAAGCA 3815156
chr14 104007555 rs12885878 A G 3815157
chr14 104007574 rs74088013 G A 3815158
chr14 104007596 rs78997778 G A 3815159
chr14 104007625 rs187937408 C T 3815160
Genes possibly regulated by ZZZ3[chr14:104007096-104007626]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:104007096-104007626]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results