Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104007242 rs78456219 G A 3815151
chr14 104007304 rs370478626 A C 3815152
chr14 104007500 rs11160753 C T 3815153
chr14 104007535 rs190626374 G A 3815154
chr14 104007539 rs112588986 G A 3815155
chr14 104007539 rs144093365 G GACAGGCTTGTTGCGAAGCA,GACAGGCTTGTTGTGAAGCA 3815156
chr14 104007555 rs12885878 A G 3815157
chr14 104007574 rs74088013 G A 3815158
chr14 104007596 rs78997778 G A 3815159
chr14 104007625 rs187937408 C T 3815160
chr14 104007683 rs113249049 G C 3815161

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results