EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:104318474-104320359]
Chromosome characteristics of ZNF143[chr14:104318474-104320359]
Back to top
Enhancers possibly regulated by ZNF143[chr14:104318474-104320359]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104318405 104331075 enh15981
Prostate (PC-3) Epithelial (MCF-7) Prostate (RWPE1) Esophagus Lung Stomach Muscle (A673) Placenta Thyroid Lung (PC-9) Pancreas Uterus Heart
SNP sites on ZNF143[chr14:104318474-104320359]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104318599 rs114871812 G A 3817141
chr14 104318711 rs112047564 G A 3817142
chr14 104318712 rs140370325 C T 3817143
chr14 104318742 rs576876040 C A 3817144
chr14 104318769 rs111633270 C T 3817145
chr14 104318787 rs12892186 C T 3817146
chr14 104318802 rs149085738 G A 3817147
chr14 104318892 rs115430479 C T 3817148
chr14 104318910 rs532990911 A G 3817149
chr14 104318913 rs61995841 G A 3817150
chr14 104318940 rs114408910 G A 3817151
chr14 104318946 rs187506700 C T 3817152
chr14 104319094 rs568369053 G A 3817153
chr14 104319155 rs554087790 G A 3817154
chr14 104319174 rs373349320 CTGCTGTTGCATTTCATGTTTGATTTT C 3817155
chr14 104319174 rs566184013 CTGCTGTTGCATTTCATGTTTGATTTT C 3817156
chr14 104319406 rs186118967 C G 3817157
chr14 104319426 rs142707793 G A 3817158
chr14 104319530 rs12897150 A T 3817159
chr14 104319551 rs370746282 G A 3817160
chr14 104319585 rs147344614 G A 3817161
chr14 104319718 rs4606645 G A 3817162
chr14 104319730 rs12878678 T C 3817163
chr14 104319797 rs182541545 G A 3817164
chr14 104319815 rs570831976 C T 3817165
chr14 104319924 rs116330316 G A,T 3817166
chr14 104319989 rs12892189 C A 3817167
chr14 104320022 rs141738670 C CA 3817168
chr14 104320047 rs555932448 T C 3817169
Genes possibly regulated by ZNF143[chr14:104318474-104320359]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:104318474-104320359]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results